T2826bul targetron vector pacd4k-c-loxp nd,phc 12-05-1.doc
TargeTron Vector pACD4K-C-loxP
Catalog Number
T2826
Storage Temperature –20 °C
TECHNICAL BULLETIN
Product Description
The TargeTron vector, pACD4K -C-loxP, is a 7,745 bp
Escherichia coli expression vector to be used in
conjunction with the TargeTron Gene Knockout
System, Catalog Number TA0100. This vector differs
from the original pACD4K -C vector in that it has loxP
sites flanking each end of the kanamycin ORF. The
addition of the loxP sites on this vector allows for
multiple site-specific knockouts in the same bacterial
chromosome. After an initial “targetron” chromosomal
insertion, the kanamycin resistance marker used to
select for insertions can be removed via Cre-loxP
mediated recombination.1,2 After removal of the
kanamycin resistance marker, sequential “targetron”
insertions can be generated.3
Map Features of TargeTron pACD4K-C-loxP vector
Map Position
loxP sites that flank the kanamycin-RAM:
5′ loxP sequence
5′ - CTACTTCGTATAGCATACATTATACGAAGTTAT - 3′
Note: The mutated 5′ loxP site shown above was found
to be more efficient than the wild-type loxP site in
conjunction with targeted group II intron insertions.
3′ loxP sequence:
5′ – ATAACTTCGTATAGCATACATTATACGAAGTTAT – 3′
B. Sub-cloning into host specific shuttle vectors
Supplied at 25 ng/µl in 10 mM Tris-HCl, pH 8.0, with
1 mM EDTA. The provided pACD4K -C-loxP vector is
The TargeTron system has previously been
linearized at the
Hind III and
BsrG I sites.
adapted to other bacterial hosts by sub-cloning the
essential intron components into shuttle/expression
Precautions/Disclaimer
vectors. Prior to sub-cloning, the pACD4K-C-loxP
This product is for R&D use only, not for drug,
vector needs to be circularized. This can be done
household, or other uses. Please consult the Material
by running the
lacZ control reaction in the
Safety Data Sheet for information regarding hazards
TargeTron kit (Product Number TA0100). For
adaptation to another host, it is advised to target an
easily screenable gene. Sub-cloning the region
bound by
Hind III and
PshA I into an alternative
host shuttle vector downstream of a host specific
promoter should result in a functional Targetron
Procedures
expression vector. The
Hind III-
PshA I region
A. Removal of kanamycin by Cre-loxP mediated
should contain the intron RNA and LtrA reverse
transcriptase coding regions, as well as the
transcriptional terminator. In the final TargeTron
1. After the initial “targetron” insertional knockout has
shuttle vector, the
Hind III and
BsrG I sites should
been confirmed, make the knockout strain
be unique since these are used to routinely re-
competent using the RapidTransit Transformation
target the intron to knockout specific genes.
Kit , Catalog Number R2653, or an alternative
2. Obtain a plasmid expressing Cre-recombinase that
has a selectable marker other than kanamycin
The lox-P kanamycin RAM is bound by two
Mlu I
(e.g., chloramphenicol, tetracycline, etc.).
sites. The loxP-kan-RAM can be removed by
Mlu I
3. Transform the knockout strain with the Cre plasmid
digestion and replaced with other DNA such as
according to the supplier’s recommendations.
promoters (for mitigating polar effects, if needed),
4. Grow and select for transformants at the
reporter genes, other antibiotic RAM-type markers,
appropriate temperature with the appropriate
etc. The
Mlu I site has been used to successfully
deliver a trimethoprim–RAM,3 a kanamycin-RAM
5. Once transformants are obtained, express the Cre
(plasmid pACD4K-C in the TA0100 kit and the
pACD4K-C-loxP plasmid provided here), and a
recommendations (e.g., shifting temperature from
lacZα gene.5 The efficiency of the intron may be
30 °C to 37 °C for plasmids with thermosensitive
affected by insertions at the
Mlu I site. A good
starting point is to attempt to insert an intron
6. Check for removal of kanamycin by replica plating
containing heterologous DNA into an easily
isolated colonies on LB and LB+Kan (25 µg/ml).
screenable or selectable gene, such as
lacZ.
7. Further verification for removal of kanamycin
(~1.0 kb) can be done by colony PCR using gene
References:
specific or intron specific primers spanning the
1. Abremski, K.
et al., J. Biol. Chem.,
261 (1), 391-396
8. The PCR amplicon can then be submitted for
2. Hartung, M.
et al., J. Biol. Chem.,
273 (36), 22884-
sequencing. There will be a single loxP scar
remaining within the “targetron” once the
3. Zhong, J.
et al., Nucleic Acids Res.,
31 (6), 1656-
4. Buchholz, F.
et al., Nucleic Acids Res.,
24 (15),
5. Jones, J.P.
et al., Mol. Ther.,
11 (5), 687-94 (2005).
RapidTransit is a trademark of Sigma-Aldrich Biotechnology.
TargeTron is a registered trademark of InGex , L.L.C.
LICENSE AGREEMENT
Academic and Non-Profit Laboratory Assurance Letter
This product and its use are the subject of one or more of U.S. Patent
The T7 system is based on technology developed at Brookhaven
Nos. 5,698,421, 5,804,418, 5,869,634, 6,027,895, 6,001,608, and
National Laboratory under contrac t with the U.S. Department of
6,306,596 and/or other pending U.S. and foreign patent applications
Energy and is the subject of patent applications assigned to
controlled by InGex, LLC. BEFORE OPENING OR USING THIS
Brookhaven Science Associates, LLC. (BSA). BSA will grant a non-
PRODUCT, PLEASE READ THE TERMS AND CONDITIONS SET
exclusive license for the use of this technology, including the
FORTH BELOW. YOUR USE OF THIS PRODUCT SHALL
enclosed material, based upon the following assurances:
CONSTITUTE ACKNOWLEDGMENT AND ACCEPTANCE OF
THESE TERMS AND CONDITIONS. If you do not agree to use this
1. These materials are to be used for noncommercial research
product pursuant to the following terms and c onditions, please
purposes only. A separate license is required for any commercial
contact Sigma Technical Services to return the unused and unopened
use, including use of these materials for research purposes or
production purposes by any commercial entity. Information about
commercial licenses may be obtained from the Office of Intellectual
The purchase of this product conveys to you, the buyer, the non-
Property & Sponsored Research, Brookhaven National Laboratory,
transferable right to use the purchased product in non-
Bldg. 475D, P.O. Box 5000, Upton, New York 11973-5000,
commercialized research conducted by you. Sigma does not have the
right to grant you a license to use this product for any other purposes.
If you wish to use this product for any non-research purposes, you
2. No materials that contain the cloned copy of T7 gene 1 , the gene
must obtain a separate commercial license from InGex LLC.
for T7 RNA polymerase, may be distributed further to third parties
Commercial entities may use this product for research and evaluation
outside of your laboratory, unless the recipient receives a copy of this
purposes for one year from the date of purchase. IF YOU ARE A
license and agrees to be bound by its terms. This limitation applies to
COMMERCIAL ENTITY, YOUR RIGHT TO USE THIS PRODUCT
strains of BL21(DE3), BL21(DE3)pLysS, and BL21(DE3)pLysE, and
EXPIRES ONE YEAR FROM THE DATE OF PURCHASE. Any
commercial entity that wishes to use this product beyond this one-
year period, must obtain a commercial license from InGex, LLC.
You may refuse this license by returning the enclosed materials
unused. By keeping our using the enclosed materials, you agree to
You may not transfer the product, its components or any materials or
information made through the use of this product for any non-
academic research related purpose (e.g., commercial research or
commercialization). You may (a) make such a transfer to a scientific
collaborator for research purposes if such collaborator agrees to
abide by the usage terms and conditions, (b) disclose in a peer
reviewed scientific publication information made through the use of
the product and (c) deposit materials made through use of the
product as required in association with a peer reviewed scientific
publication, provided the recipient is under an obligation not to use or
distribute the materials for any non-research purpose (d) transfer any
materials used in the published experiments freely to academic
researchers for their own research purposes. Your right to use the
product will terminate immediately if you fail to comply with these
terms and conditions. You shall, upon such termination of your rights,
destroy all product and components thereof in your control, and notify
For information on purchasing a license to this product for purposes other than non-commercial research, contact Licensing Department, InGex, LLC, 3655 Vista Ave, St. Louis, MO 63110, 314-865-0113.
Sigma brand products are sold through Sigma-Aldrich, Inc.
Sigma-Aldrich, Inc. warrants that its products conform to the information contained in this and other Sigma-Aldrich publications. Purchaser
must determine the suitability of the product(s) for their particular use. Additional terms and conditions may apply. Please see reverse side of
Source: http://www.sial.co.kr/promotion/sig/2009_q2_promotion/img/t2826bul.pdf
Sex, health, and years of sexually active life gained due togood health: evidence from two US population based crosssectional surveys of ageingStacy Tessler Lindau, associate professor,1,2 Natalia Gavrilova, senior research associate1with their peers in poor or fair health. Women in very goodObjectives To examine the relation between health andor excellent health gained 3-6 years compared with
MEDICAL SUMMARY REPORT----SAMPLE---SAMPLE---SAMPLE Personal History Joe is a 32 year-old, white male. Joe has been using methamphetamine for the past eight years, smoking the drug 3-6 per week. He is the middle of three siblings. He has an older sister and a younger brother. Joe was born and raised in Arkansas. He moved to the West Coast at the age of 20. He was thrown out of the family home