He encontrado que alguna farmacia puede tener existencias limitadas de ciertos medicamentos, mientras que otras pueden tener casi cualquier formato que se le ocurra y el habitual de dosis habitualidad apareció. En resumen, siempre se contiene el almacén de corroborar. Al mismo tiempo que el producto que más que gustaba ha resultado no estaba disponible en stock otro distinto por las Buenas costumbres también debe buscarse jefe no asн parezca. Por eso es importante disponer de un Plan B para actuar cuandod ello no ocurra. Ventaja de tomar un genérico en lugar de Asix Un genérico es más barato que el nombre de marca Uno de los mayores incentivos para someterse al Dónde comprar Lasix genérico en lugar de pagar la marca es que usted puede obtener un ahorrando importantes Lasix genérico. Por lo tanto, un Lasix genérico es en general mucho más barato que el homólogo de marca, así que una denominación genérica se hace posible para las personas que usan este medicamento con frecuencia. Un ejemplo: La compra de lurosemida en lugar de Lasix es una considerable ahorro para el presupuesto mensual de medicamentos.

Untitled

Appl Microbiol Biotechnol (2004) 65: 110–118 A P P L I E D M I C R O B I A L A N D C E L L P H Y S I O L O G Y A. Sajidan . A. Farouk . R. Greiner . P. Jungblut .
E.-C. Müller . R. Borriss Molecular and physiological characterisation of a 3-phytasefrom soil bacterium Klebsiella sp. ASR1 Received: 11 September 2003 / Revised: 10 November 2003 / Accepted: 21 November 2003 / Published online: 16 January 2004 Abstract Klebsiella sp. strain ASR1 isolated from an Indonesian rice field is able to hydrolyse myo-inositolhexakis phosphate (phytate). The phytase protein was Phytate (myo-inositol 1,2,3,4,5,6-hexakisphosphate) is the purified and characterised as a 42 kDa protein accepting main storage form of phosphorous in plants and accounts phytate, NADP and sugar phosphates as substrates. The for 20–50% of total soil organic phosphorous (Selle et al.
corresponding gene (phyK) was cloned from chromosomal ). Due to limitation of digestible phosphorous in plant DNA using a combined approach of protein and genome and in animal nutrition, it is still common practice to add analysis, and expressed in Escherichia coli. The recom- inorganic phosphorous as plant fertiliser and as an animal binant enzyme was identified as a 3-phytase yielding myo- feed supplement. Especially in areas of intensive crop and inositol monophosphate, Ins(2)P, as the final product of livestock production, this can lead to environmental enzymatic phytate hydrolysis. Based on its amino acid pollution when phytase-producing soil microorganisms sequence, PhyK appears to be a member of a hitherto hydrolyse phytate to release inorganic orthophosphate into unknown subfamily of histidine acid phytate-degrading enzymes with the active site RHGXRXP and HD sequence Improved phosphorous nutrition is achievable by motifs, and is different from other general phosphatases mobilisation of phytate phosphorous by phytate-degrading and phytases. Due to its ability to degrade sodium phytate enzymes (phytases). Aspergillus niger phytase is currently to the mono phosphate ester, the phyK gene product is an in use as a supplement of animal diet in order to improve interesting candidate for industrial and agricultural phosphorus utilisation. Based on sequence homology, applications to make phytate phosphorous available for phytases (EC 3.1.3.8 for 3-phytase and EC 3.1.8.26 for 6- phytase) can be divided into histidine acid phosphatases,plant purple acid phosphatases and Bacillus beta-propellerphytases. Besides their ability to make phytate phospho-rous available, elimination of chelate-forming phytate,which is known to bind nutritionally important minerals is Electronic Supplementary Material Supplementary material is another beneficial effect of phytase activity (Reddy et al.
available in the online version of this article at http://dx.doi.
). Most of the known microbial phytases are encoded by genes that have evolved from histidine acid phospha- A. Sajidan . A. Farouk . R. Borriss (*) tases containing the RHGXRXP sequence motif (Mitchell Department of Bacterial Genetics, Institute of Biology, et al. With the exception of the E. coli appA gene (Dassa et al. ), and despite the high number of cloned fungal phytase genes, there is little information about 10115 Berlin, Germanye-mail: [email protected] bacterial phytase sequences. In fact, the only phytase genes known to date from soil bacteria are derived from Bacillus spp. (Tye et al. These do not contain theRHGXRXP sequence motif and may have evolved from a R. GreinerCentre for Molecular Biology, Federal Research Centre for Bacillus alkaline phosphatase ancestor (Idriss et al. The native phytase produced by Klebsiella terrigena has been isolated and characterised as a 3-phytase (EC 3.1.3.8;Greiner et al. ); however, the genes encoding Klebsiella spp. phytase are still unknown.
Max Delbrück Centre for Molecular Medicine,13125 Berlin, Germany To extend our present knowledge about bacterial Isolation, PCR amplification, sequencing and cloning of DNA phytases we performed a survey of phytase-producing bacteria sampled from soil of an Indonesian rice field.
Genomic DNA from bacteria was isolated from logarithmic growing Here we report the gene sequence encoding a phytate- culture by conventional phenol/chloroform extraction (Sambrook et degrading enzyme from Klebsiella sp. ASR1 and the al. ). Amplification of the 16S rDNA with sequence-specific functional characterisation of its product, which degrades primers 27f 5′ GAGAGTTTGATCCTGGCTCAG 3′ and 765r 5′ phytate to myo-inositol monophosphate [Ins(2)P]. The CTGTTTGCTCCCCACGCTTTC 3′ yielding a 738 bp fragment, was carried out as described previously (Damiani et al. For deduced amino acid sequence of the 3-phytase-encoding cloning the phytase gene, a 1,263 bp coding region fragment was gene phyK was found to be distinct from that of other amplified from the genomic DNA of Klebsiella sp. ASR1 using known bacterial phytase genes, but it contains sequence primers AS23 [forward: 1–27]: 5′ atgcaagacatcaggggctgttacgcc 3′ motifs generally conserved in histidine acid phosphatases.
and AS22 [reverse: 1,257–1,233]: 5′ cggcaggaccatggctaccgccgg 3′.
The initial denaturation step was performed for 4 min at 94°C, andwas followed by 30 cycles as follows: denaturation at 94°C for1 min, annealing at 54°C for 1 min, and extension at 72°C for 2 min.
A final extension step at 72°C for 8 min was carried out.
For expression cloning of phosphatase genes, genomic DNA was partially degraded by digestion with Sau3AI. Following electropho-resis, fragments of 3–15 kb were eluted from agarose gels using a Qiaex system (Qiagen, Hilden, Germany). Fragments were ligated Most of the enzyme substrates were purchased from Merck into dephosphorylated BamHI-linearised pUC18 vector. After (Darmstadt, Germany). Phytic acid dodecasodium salt was from transformation into E. coli DH5α, collected plasmid DNA was Sigma (Steinheim, Germany). All other chemicals such as restriction retransformed into the phoA− E. coli GE334 in order to avoid enzymes, salt alkaline phosphatase (SAP), T4 DNA ligase and Taq endogenous background phosphatase activity due to the host cells.
polymerase were purchased from Appligene (Illkirch, France), Phosphatase-expressing clones were detected on LB plates by their Promega (Heidelberg, Germany), and USB Biochemicals (Cleve- brown-red colour after developing with a reagent containing 1- land, Ohio), and were used according to the instructions of the naphthyl phosphate (0.1%, w/v), Fast Garnet salt (Sigma, 0.1% w/v) manufacturers. The oligonucleotides were products from Genset and 0.5 M sodium acetate buffer pH 5.
Oligos (France). S-Sepharose, Q-Sepharose, Blue Sepharose and DNA sequences were determined with an automatic sequencing Superdex 2000 were obtained from Pharmacia (Freiburg, Germany).
system (ALF, Pharmacia). Sequence analysis was performed withOmiga (Oxfords Molecular, Oxford, UK), ClustalW (Thompson etal. ), and PAUP (phylogenetic analysis using parsimony; The isolated gene fragments were inserted between the NdeI and E. coli strains DH5α (Sambrook et al. GE334 (leuB6 lac- HindIII sites of pET 22b(+) vector (Novagen, Madison, Wis.) and 290, tsx-96 recA1 rpsE2018 aroE24 rpsL86 cysG132 malT1 gal-290 transformed into E. coli C41(DE3) in order to express enzyme ilv591 ΔphoA, kindly supplied by P. Belin, Gif-sur-Yvette, France) and C41(DE3), a derivative of BL21(DE3) (Miroux and Walker) were grown in Luria-Bertani broth (LB; Sambrook et al.
).
Purification of native Klebsiella phytase Cells were disrupted by sonication. Cell debris and proteins Isolation and characterisation of phytase-producing strains precipitated at 30% ammonium sulfate saturation were removedby centrifugation and the cleared supernatant was subjected to Bacterial strains were isolated from a soil sample taken from an ammonium sulfate precipitation at 70% saturation. The protein Indonesian rice (Oryza sativa var. IR64) field in the direct vicinity of material obtained was dialysed against 25 mM sodium acetate, the plant roots. The diluted sample was plated on MA agar (see pH 5.4. Purification of phytase was carried out by FPLC chroma- below) containing 1% pancreatic peptone; 0.5% soya peptone; 0.2% tography with S-Sepharose, Blue-Sepharose, Q-Sepharose and phytic acid dodecasodium salt, and 0.25% calcium chloride. The Superdex TM 2000 (see Electronic Supplementary Material).
plates were incubated at 37°C for 3 days. Five hundred isolates fromsoil sampled from an Indonesian rice field were tested for phytaseactivity using the disappearance of precipitated calcium phytate as an indication of enzyme activity (Bae et al. ). Bacterial strainshydrolysing phytate agar were cultivated in liquid MAS medium Phytase activity was assayed in 0.1 M sodium acetate pH 5.4 with [MA medium supplemented with 0.5% MgSO4, 0.5% MgCl2, 0.2% phytic acid dodecasodium salt as previously described (Greiner et al.
NaCl, 0.05% KCl, 0.05% CaCl2, and 1% glucose (w/v)] and tested One unit of activity was defined as the amount of enzyme for cellular-bound phytase activity. Finally, four strains were that liberated 1 µmol phosphate in 1 min at 37°C. Phosphatase confirmed as potent producer strains with activities ranging between activities were measured with the substrate p-nitrophenyl phosphate 10 and 20 mU (mg protein)−1 (ASR3, ASR4, and ASR5) and 100– (0.4% w/v) in 0.1 M sodium acetate buffer pH 5 or Tris-HCl buffer 200 mU (mg protein)−1 (ASR1). Strain ASR1 was chosen for further pH 8. One unit of activity was defined as described for phytase studies. ASR1 was characterised as a Gram-negative Klebsiella sp.- like bacterium: not motile, rod-shaped, Gram-negative, negative in To detect phosphatase activity in SDS PAGE gels, the gel was Voges Proskauer reaction and in indole and Methyl red test, positive incubated for 1 h in 1% Triton X100 and then incubated for a further in Simmon citrate agar, resistant against ampicillin and producing β- hour in 25 mM sodium acetate, pH 5.4. Finally, the gel was incubated in a solution of 1-naphthyl phosphate and Fast Garnet salt 16S ribosomal DNA (rDNA) analysis (see below) revealed that (Sigma), 0.1 and 0.2% (w/v), in 25 mM sodium acetate, pH 5.4, ASR1 was a representative of Klebsiella sp. displaying close sequence homology to Klebsiella pneumoniae (Sajidan ).
Protein concentrations were determined by the method of ASR1 was deposited in the DSMZ culture collection as Klebsiella Bradford using bovine serum albumin as standard. Specific enzyme activities are defined as milliunits per milligram cell protein.
Protein identification by matrix assisted laser desorption/ionisation mass spectroscopy (MALDI-MS) was performed as describedpreviously (Jungblut et al. In brief, the excised 42 kDa The Klebsiella sp. ASR1 nucleotide sequence data reported has been protein band resolved by SDS-PAGE was subjected to in-gel tryptic deposited in the GenBank nucleotide sequence database under digestion. The resulting peptide mixture was desalted using ZipTips accession numbers AF453251 (16S rDNA), AF453252 (aphA), (Millipore, Bedford, Mass.). Mass spectra were acquired using MALDI-MS (Voyager Elite spectrometer; Perseptive, Framingham,Miss.). The amino acid sequences of the proteolytic peptides wereused in subsequent database searches with the program MS-FIT(http://www.prospector.ucsf.edu/ucsfhtml/msfit.hm) in the NCBIdatabase MGH78578). Partial enzymatic cleavages leaving two cleavagesites, oxidation of methionine, pyroglutamic acid formation at the N- Production and purification of native phytase from terminal glutamine, and modification by acrylamide were consid-ered in these searches.
Direct identification of peptide sequences from the tryptic digest of the 42 kDa protein was performed with the aid of the highly Soil bacterium Klebsiella sp. ASR1 was characterised as a sensitive nanoflow-electrospray mass spectrometry technique em- potent producer strain for cell bound phytase (see ploying a hybrid quadruple time of flight mass spectrometer (Q-Tof;Micromass, Manchester, UK) with a nanoflow electrospray ion Materials and methods). Phytase was prepared from a 20 l culture of stationary phase cells grown for 16 h inMAS medium. Following ammonium sulfate precipitationand several steps of ion exchange column chromatography Expression and purification of recombinant phytase and a final gel filtration step, phytase activity was morethan 1,200 times enriched from cell extract (see Electronic Recombinant E. coli strain C41(DE3) was cultured at 30°C in LB Supplementary Material). Analytical SDS-PAGE revealed containing ampicillin (50 µg/ml). At OD600=0.6, phytase expressionwas induced by addition of isopropyl-β- a protein with an apparent molecular mass of 42 kDa with (IPTG, final concentration 1 mM) and the cultures were further activity against 1-naphthyl phosphate in direct gel staining incubated at 30°C for 6 h. The cells were collected by centrifuga- (see Electronic Supplementary Material). Pooled fractions tion, suspended in 20 mM Tris-HCl/500 mM NaCl pH 7.9, and containing the 42 kDa protein displayed specific activities sonicated. After centrifugation, phytase was purified from the of 224 U mg−1 using phytate and 49 U mg−1 using p- supernatant by affinity chromatography with Ni-NT agarose(Qiagen).
nitrophenyl phosphate as substrate. Apparent molecularmass and specific activities of the enzyme prepared fromASR1 are similar to those described for phytase from K.
Identification of enzymatically formed hydrolysis products Enzyme and sodium phytate were incubated in 0.1 M sodium Cloning and expression of alkaline and acid acetate buffer pH 5.4 as described for activity determination(Greiner et al. ). From the incubation mixture, samples (200 μl) were removed periodically and the reaction was stopped by heat treatment (90°C, 5 min); 50 μl of the heat-treated samples Our first strategy to clone the phytase-encoding gene from was resolved on a high performance ion chromatography (HPIC) Kl. pneumoniae was based on the unspecific phosphatase system using a Carbo Pac PA-100 (4×250 mm) analytical columnand a gradient of 5–98% HCl (0.5 M, 0.8 ml min−1) as described activity of the purified 42 kDa phytase (see above). A (Skoglund et al. ). The eluants were mixed in a post-column plasmid library prepared from a Sau3A partial digest of reactor with 0.1% Fe(NO3)3·9H2O in a 2% HClO4 solution chromosomal DNA was used to clone genes encoding (0.4 ml min−1) (Phillippy and Bland ). The combined flow enzymes with phosphatase activity. Only transformants that were able to hydrolyse 1-naphthyl phosphate butunable to hydrolyse phytate were selected and used forDNA sequencing. Clones with more than 90% sequence Identification of the myo-inositol monophosphate isomer identity to E. coli alkaline phosphatase (phoA, AF 453253) Myo-inositol monophosphate was produced by incubation of 1.0 U and acid phosphatase (aphA, AF 453252) genes were legume phytase (Greiner et al. with a limiting amount of myo- obtained. Expression cloning of the phoA- and aphA-like inositol hexakisphosphate (0.1 µmol) in a final volume of 500 µl genes in pET22b(+) with subsequent purification of the 50 mM NH4-formate. After lyophilisation, the residues were His-tagged proteins bound on Ni NT agarose columns dissolved in 500 µl of a solution of pyridine:bis (trimethylsilyl)trifluoroacetamide (1:1 v/v) and incubated at room temperature for confirmed that we had cloned an alkaline phosphatase 24 h. The silylated products were injected at 270°C into a gas exhibiting a pH maximum at 8.5–9.0 and an acid chromatograph coupled with a mass spectrometer (GC-MS). The phosphatase with a pH optimum at 4.0–5.0.
stationary phase was methyl silicon in a fused silica column(0.25 mm ×15 m). Helium was used as the carrier gas at a flow rateof 0.5 m s−1. The following heating program was used for thecolumn: 100–340°C, rate increase: 4°C min−1. Ionisation was performed by electron impact at 70 eV and 250°C.
Cloning of the phytase gene using sequence information obtained by nanoflow-electrospray massspectrometry of the trypsinised 42 kDa protein The deduced amino acid sequence of the phyK gene is a421 amino acid protein with a molecular mass of The tryptic digest of the 42 kDa protein band excised from 46,239 Da. The first 27 N-terminal amino acids form a SDS PAGE was subjected to MALDI MS. Since this cleavable signal peptide with a putative processing site peptide mass fingerprinting revealed that no protein AAA↓ADWQ (Nielsen et al. The amino acid homologous to ASR1 phytase has been deposited within sequence of the mature protein contains the active site the protein databases, the highly sensitive nanoflow- motif RHGXRXP that is shared by other histidine acid electrospray mass spectrometry technique was applied in phosphatases and phytases (Mitchell et al. order to obtain specific sequence information of the An extensive tBLASTN search in available databases, Klebsiella sp. ASR1 phytase. This method allows direct including unfinished and finished genomes, was per- mass spectrometric sequencing of the peptides (Müller et formed in order to detect proteins similar to PhyK. The al. ). The resulting peptide sequences, together with highest similarity was detected with two putative phytases sequences already obtained for K. terrigena phytase (R.
from Pseudomonas syringae. Similarity scores signifi- Greiner, unpublished), were used for similarity searches cantly higher than with AppA (Dassa et al. were (tBLASTN) within unfinished and finished bacterial also found in ORFs in the genomes of two Xanthomonas genomes. We were able to detect significant homology species, Yersinia pestis, and Caulobacter crescentus.
to an open reading frame (ORF) located between nucle- Pairwise alignment (Needleman and Wunsch ) of otides 22,323 and 21,061 in contig118 of the unfinished the whole sequences identified as similar to PhyK genome of the human pathogenic K. pneumoniae confirmed the close relatedness of the Klebsiella phytase MGH78578 (McClelland et al. ). Using this sequence with the putative phytases detected in the genomes of P.
information, a fragment of 1,263 bp was amplified from syringae strains. Moreover, PhyK also displays homology chromosomal DNA isolated from soil strain ASR1. The to members of the yeast histidine acid phosphatase deduced amino acid sequence of the fragment exhibited superfamily with 3- or 6-phytase activity, including MGH78578. The identity of the amplified sequence with An amino acid sequence alignment was performed the protein isolated from Klebsiella sp. ASR1 was using ClustalW (Thompson et al. and the data were confirmed by mass spectrometric measurements. PhyK used to generate a phylogenetic tree. The tree obtained was sequence was covered to 39.6% by the MALDI-MS used as starting point for parsimony heuristic search with peptide spectrum of the trypsinised 42 kDa protein bootstrap support. The topology of the resulting phyloge- isolated from Klebsiella sp. ASR1, which is well above netic tree was very similar to the tree obtained by the the cut-off for correct protein identification of 30% neighbour joining (genetic-distance) method. Klebsiella sp. ASR1 acid phosphatase forms a separate branch toother members of the histidine acid phosphatase familycharacterised by the RHGXRXP active site motif. Withinthis family, PhyK and two predicted phytases from P.
syringae cluster on a separate branch, which is clearlydistinct from E. coli AppA, glucose-1-phosphatase and Sequence comparison of microbial histidine acid phytases pneumoniae was used for comparison and displays no significant by EMBOSS Align (http://www.ebi.ac.uk/emboss/align/). The homology to PhyK. Percentages of identical (% identity) and similar deduced amino acid sequence of acid phosphatase, aphK from K.
(% similarity) amino acid residues are presented other unknown proteins predicted to be histidine acid phytase was purified from the culture supernatant by affinity chromatography on Ni NT agarose yielding asingle homogeneous band in SDS-PAGE with a specificactivity of 169 U (mg protein)−1 when assayed at the Expression, purification and properties of recombinant The host E. coli C41 (DE3) was used for over-expression of the phyK gene. Part of the phyK gene encoding themature phytase was fused in-frame with the pelB signal Recombinant Klebsiella sp. ASR1 phytase has a single pH peptide under the control of the strong IPTG-inducible T7 optimum at pH 5.0. The enzyme is virtually inactive at RNA polymerase promoter present in vector pET22b(+).
values less than pH 4.0 and above pH 7.0. No shift in pH Transformed C41 cells started to express phytase 2 h after optimum was detected with p-nitrophenyl phosphate as an IPTG induction. Initially, some cell-bound activity was alternative substrate for the recombinant phytase.
detected, but the majority of the activity was found in theculture filtrate 8 h after induction. Since the pelB signalpeptide enables only SecA-dependent export into the Temperature optimum and thermal stability periplasmic space, the extracellular phytase activitydetected might be attributed to unspecific lysis of IPTG- The temperature profile of the purified recombinant induced recombinant E. coli cells. His-tagged recombinant phytase was determined from 4°C to 70°C using thestandard phytase assay at the given temperature. Enzymeactivity increased with increasing temperature up to 45°Cand declined above 50°C. Thermal stability was testedfrom 0°C to 95°C. The phytase was fairly stable for15 min when incubated in temperatures from 0°C to 45°C.
However, between 55°C and 60°C, enzyme activitydropped significantly. If incubated at 65°C, no phytaseactivity was detectable. In summary, the pH and temper-ature behaviour of the recombinant ASR1 enzyme weresimilar to the biochemical properties of the native phytaseof Klebsiella sp. ASR1 (Sajidan ) and those reportedfor K. terrigena phytase (Greiner et al. ).
The actions of native and recombinant phytase PhyK, andof the acid phosphatase AphK from Klebsiella sp. ASR1on several phosphorylated compounds were comparedwith data reported for the 3-phytase of K. terrigena(Greiner et al. the 6-phytase AppA from E. coli(Golovan et al. ) and Bacillus amyloliquefaciensphytase (Greiner et al. The relative rates ofenzymatic hydrolysis performed at 37°C are summarisedin Table Like E. coli AppA and K. terrigena phytase,PhyK is specific for phytate, displaying activity towardsphytate over four times higher than that towards p-nitrophenyl phosphate, and 20- to 40-fold higher than Phylogenetic tree of bacterial histidine acid phosphatases towards 2-naphthyl phosphate and 1-naphthyl phosphate.
genes on deduced protein level constructed by random stepwiseparsimony using the PAUP program package (Swofford 2002), In contrast, no activity of recombinant ASR1 acid and supported by 1,000 bootstrap repetitions. phyK_AS Klebsiella sp.
alkaline phosphatases AphK and PhoK towards sodium ASR1 3-phytase, phyP_MOK1 Pseudomonas syringae MOK1 putative phytase, phyP_B728a Pseudomonas syringae B728A Differences in specific activity determined at pH 5 and putative phytase, phyX_Xa Xanthomonas axonopodis putativephytase, phyX_Xc Xanthomonas campestris putative phytase, 37°C of the native phytase (224 U mg protein−1) and the phyC_Cc Caulobacter crescentus putative phytase, appA_Yp Yer- recombinant phytase (99 U mg protein−1) were observed.
sinia pestis_KIM acid phosphatase, appA_Eco, Escherichia coli These differences might be due to the presence of the His- phytase, agp_Eco E. coli glucose-1-phosphatase, aphK Klebsiella tagged C-terminus and/or the presence of some denatured sp. ASR1 acid phosphatase, phoK Klebsiella sp. ASR1 alkaline material in the preparation of the recombinant enzyme.
phosphatase. Members of the phyK family of acid histidinephosphatase are boxed. For accession numbers see Table 1 Km value obtained for recombinant phytase, Substrate specificities of selected phytases and of the acid phosphatase AphK from Klebsiella sp. ASR1. All enzyme activities were assayed at 37°C. Relative activities compared to phytate (100%) are shown aNative phytase purified from Klebsiella pneumoniae ASR1bRecombinant phytase from K. pneumoniae ASR1 expressed in E. colicNative phytase, purified from Klebsiella terrigena. Data from Greiner et al. 1997dNative phytase, purified from E. coli. Data from Golovan et al. 2000eRecombinant phytase from Bacillus amyloliquefaciens FZB45. Data from Greiner et al. 2002fRecombinant acid phosphatase from Klebsiella pneumoniae nPhyK, native phytase purified from Klebsiella sp. ASR1 280 µmol l−1 phytate, is similar to that reported for K.
terrigena (Greiner et al. ). The kcat/Km value of therecombinant Cloning of the phyK gene from a soil isolate ASR1 23.57 s−1 µmol l−1 exceeds by far the value of 0.65 identified as Klebsiella sp. was achieved by successful s−1 µmol l−1 determined for the substrate p-nitrophenyl purification and partial amino acid sequencing of the phosphate, again suggesting that phytate is the preferred protein revealing similarity to an ORF identified in the unfinished genome of the human pathogenic K. pneumo-niae strain MGH78578. Phytases seem to be common inKlebsiella spp. since an ORF homologous to phyK is present in strain MGH78578, and a phytase of K.
terrigena with properties similar to the ASR1 enzyme The hydrolysis products of the recombinant phytase were has been reported (Greiner et al. ). Until now, the E.
separated by HPLC, ion pair chromatography, and ion coli periplasmic phospho-anhydride phosphohydrolase exchange chromatography (Fig. The results suggested AppA (Dassa et al. ), which has been characterised possible myo-inositol hexakisphosphate degradation path- as 6-phytase (EC 3.1.3.26, Greiner et al. ), is the only ways by the Klebsiella sp. ASR1 PhoK phytase as characterised bacterial representative of histidine acid outlined in Fig. Stepwise dephosphorylation occurs phosphatases possessing the RHGXRXP and the HD via (1) myo-inositol pentakisphosphate, D/L-Ins(1,2,4,5,6) motifs. The mature PhyK displayed only a weak sequence P5; (2) myo-inositol tetrakisphosphates, D/L-Ins(1,2,5,6)P4 similarity of 25% identical residues to E. coli phytase or Ins(2,4,5,6)P4; (3) myo-inositol trisphosphates, D/L-Ins AppA. However, active site residues H17 (nucleophilic (1,2,6)P3 or Ins(1,2,3)P3 or D/L-Ins(1,4,5)P3; and (4) myo- acceptor) and H303/D304 (proton donor) in the sequence inositol bisphosphates, D/L-Ins(1,2)P2 or Ins(2,5)P2 or D/L- A/G-H-D-T-X-I/L, and the residues R16, R20, and R92, Ins(4,5)P2 and D/L-Ins(2,4)P2. myo-Inositol monophos- which together with H303 and D304 are probably phate, Ins(2)P was identified as the final product of involved in coordinating the scissile 3-phosphate (Lim et al. are well conserved in both enzymes. Alignmentto conserved domains (CD alignment) of the mature PhyKsequence by RPS-Blast with the conserved domaindatabase (CDD) revealed a similarity score of 80 bits (e-value: 4e-16) to the histidine acid phosphatase domain High performance ion chromatography (HPIC) analysis on sodium phytate. Enzyme and substrate were incubated at pH 5.0 of hydrolysis products of myo-inositol hexakisphosphate by the and reaction products were analysed by HPIC (see Materials and purified recombinant phytate-degrading enzyme PhyK from Kleb- methods): 1D/L-Ins (1,2,3,4,5,6)P6, 3D/L-Ins (1,2,4,5,6)P5, 7D/L-Ins siella sp. ASR1. A Profile of the reference myo-inositol phosphates.
(2,4,5,6)P4, 8D/L-Ins (1,2,5,6)P4, 17D/L-Ins (1,2,5)P3, 18D/L-Ins The source of the reference myo-inositol phosphates is as indicated (1,2,6)P3, 21D/L-Ins (2,4) P2, 22 Ins (1,2)P2 in Skoglund et al. (1998). B Action of purified recombinant phytase pfam00328 (gn1│CDD │7564, http://www.ncbi.nlm.nih.
phosphatases have been classified either as six-bladed propeller alkaline phosphatases (Shin et al. or as The deduced amino acid sequence of the phyK gene, purple acid phosphatases (Hegemann and Grabau ).
although containing the functional residues of histidine The specific activity of the native Klebsiella sp. ASR1 acid phosphatases, displayed only 25% overall homology phytase (224 U mg−1) exceeds the activity of phosphatase to AppA and 15–17% to fungal histidine acid phytases, measured against p-nitrophenyl phosphate (49 U mg−1) suggesting that PhyK represents a novel subfamily of 4.56 times. In general, the presence of substantial amounts histidine acid phytate-degrading enzymes that is clearly of unspecific phosphatase activity is typical of phytases distinct from the other previously characterised members belonging to the histidine acid phosphatase family (Wyss of this family. Other bacterial and plant phytases not et al. but the ratio, together with a significant lower containing the signature sequences of histidine acid Km, characterises PhyK as a true phytase. With the D/L-Ins(1,2,6)P3 and D/L-Ins(1,2)P2 or D/L-Ins(2,4)P2 D/L-Ins(1,2,5)P3 and D/L-Ins(1,2)P2 or Ins(2,5)P2 D/L-Ins(2,5,6)P3 and Ins(2,5)P2 or D/L-Ins(2,4)P2 Ins(2,4,5,6)P4 can only be degraded via Ins(2,4,6)P3 and D/L-Ins(2,4)P2 to, finally, Ins(2)P. Since pure Ins(2,4,6)P3 is not available, it was impossible to prove, or toexclude, the generation of Ins(2,4,6)P3. If in factgenerated, it possibly eluted together with Ins(1,4,5)P3.
The experimentally supported pathway of phytate degra-dation is clearly different from that reported for otherbacterial phytate-degrading enzymes, but is similar to thatof the phytase of K. terrigena (R. Greiner, unpublishedobservation). The E. coli phytate degrading enzyme P2,which is identical to the appA gene product (Golovan etal. ), initially dephosphorylates myo-inositol hexaki-sphosphate at the 6-position followed by sequentialremoval of phosphate groups at the 1- and 3-position.
The resulting myo-inositol trisphosphate is degradedfurther to Ins(2,5)P2 and Ins(2)P as final product ofhydrolysis following the notation 6/1/3/4/5 (Greiner et al.
). Recently, the 3-phytase from Bacillus was charac-terised as using two independent routes of degradation ofD-Ins(1,2,3,4,5,6)P6 via Ins(2,4,5,6)P4 and D-Ins(1,2,5,6) Suggested degradation pathways of phytate by phytase P4. However, in Bacillus the main end products of PhyK from Klebsiella sp. ASR1. Ins(2,4,6)P3 is unavailable as a enzymatic phytate hydrolysis are myo-inositol trispho- reference compound in HPIC experiments (see Discussion), there- sphates. The final monophosphate Ins(2)P, which is fore it could not be excluded as a degradation intermediate generated via D-Ins(2,6)P2, is detectable only afterprolonged incubation of Ins(1,2,6)P exception of E. coli AppA, specific activities reported for enzyme concentrations (Greiner et al. Therefore, other bacterial and fungal phytases are in the same range different phytases generate different products of enzymatic (Greiner et al. ; Lassen et al. as found for hydrolysis, which might be desirable in specific applica- PhyK. E. coli phytase is reported to possess a specific tions. Moreover, the action of several phytate-degrading activity for hydrolysis of myo-inositol hexakisphosphate of enzymes could lead to synergistic effects in phosphate 1,800 U mg−1, i.e. exceeding by 8-fold the specific activity mobilisation in animal feed and under environmental of the commercially used A. niger phytase (Golovan et al.
conditions such as in the plant rhizosphere (Richardson et al. which is colonised by different phytase- Our data suggest that Klebsiella phytase dephosphor- producing beneficial microorganisms, e.g. Bacillus spp ylates myo-inositol hexakisphosphate by sequential re- (Idriss et al. Pseudomonas spp (Irving and moval of phosphate groups via two independent routes. In Cosgrove ) and Klebsiella spp (Chelius and Triplett contrast to E. coli AppA (EC 3.1.26), but similar to fungal ). The potential of microbial phytases for stimulating phytases, PhyK was characterised as a 3-phytase (EC plant growth under conditions of limited access to 3.1.3.8), since the phosphoester bond at position 1 or 3 of phosphate in complex environmental systems such as the the myo inositol residue is preferentially hydrolysed soil micro-cosmos remains to be further elucidated.
yielding D/L-Ins(1,2,4,5,6)P5 as the first degradationproduct. The two independent pathways proceed eithervia Ins (2,4,5,6)P 4 or D/L-Ins(1,2,5,6)P4 (Fig. ). Since all theoretically existing myo-inositol pentakis- and tetraki- gratefully acknowledged. We are especially grateful to MonikaSchmid for analysis of peptide masses and Thomas Leya for his help sphosphate isomers are well resolved on the HPIC system in using the PAUP package for construction of evolutionary trees.
used, the identity of the myo-inositol pentakis- and We thank Romy Scholz and Kristin Rosner for their support in DNA tetrakisphosphate isomer produced by the Klebsiella sp.
sequence analysis. Dr. Steffen Porwollik is thanked for critical reading of the manuscript. The technical assistance of Christiane Müller and Sybille Striegl is gratefully acknowledged.
4 is well established. A clear identifica- tion of the formed myo-inositol tris-, bis- and monophos-phate isomers by HPIC cannot be achieved since not all theoretically possible isomers are available. D/L-Ins(1,2,5,6)P4 may be degraded to Ins(2)P via the following Bae HD, Yanke LY, Cheng KJ, Selinger LB (1999) A novel staining method for detecting phytase activity. J Microbiol Methods39:17–22 Bradford MM (1976) A rapid sensitive method for the quantitation Miroux B, Walker JE (1996) Over-production of proteins in of microgram quantities of protein utilizing the principle of Escherichia coli: mutant hosts that allow synthesis of some protein dye binding. Anal Biochem 72:248–254 membrane proteins and globular proteins at high levels. J Mol Chelius MK, Triplett EW (2000) Immunolocalization of dinitro- genase reductase produced by Klebsiella pneumoniae in Mitchell DB, Vogel K, Weimann J, Pasamontes L, vanLoon AP association with Zea mays. Appl Environ Microbiol 66:783– (1997) The phytase subfamily of histidine acid phosphatases: isolation of two genes for two novel phytases from the fungi Damiani G, Amedeo P, Bandi C, Fani R, Bellizi D, Sgamarella V Aspergillus terreus and Mycoliophthora thermophila. Microbi- (1996) Bacteria identification by PCR-based techniques. In: Adolph KW (ed) Microbial genome methods. CRC Press, Boca Müller EC, Schümann M, Rickers A, Bommert K, Wittmann- Liebold B, Otto A (1999) Study of Burkitt lymphoma cell line Dassa J, Marck C, Boquet PL (1990) The complete nucleotide proteins by high resolution two-dimensional gel electrophoresis sequence of the Escherichia coli gene appA reveals significant homology between pH 2.5 acid phosphatase and glucose-1- Needleman SB, Wunsch CD (1970) A general method applicable to Golovan S, Wang G, Zhang J, Forsberg CW (2000) Characterization the search for similarities in the amino acid sequence of two and overproduction of the Escherichia coli appA encoded bifunctional enzyme that exhibits both phytase and acid Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) phosphatase activities. Can J Microbiol 46:59–71 Identification of prokaryotic and eukaryotic signal peptides Greiner R, Haller E, Konietzny U, Jany KD (1997) Purification and and prediction of their cleavage sites. Protein Eng 10:1–6 characterization of a phytase from Klebsiella terrigena. Arch Phillippy BQ, Bland JM (1988) Gradient ion chromatography of inositol phosphates. Anal Biochem 175:162–166 Greiner R, Carlsson NG, Alminger ML (2000) Stereospecificity of Reddy NR, Pierson MD, Sathe SK, Salunkhe DK (1989) Phytases in myo-inositol hexakisphosphate dephosphorylation by a phytate- cereals and legumes. CRC Press, Boca Raton, Fla.
degrading enzyme of Escherichia coli. J Biotechnol 84:53–62 Richardson AE, Hadobas PA, Hayes JE, O’Hara JE, Simpson RJ Greiner R, Muzquiz M, Burbano C, Cuadrado C, Pedrosa MM, (2001) Utilization of phosphorous by pasture plants supplied Goyoaga C (2001) Purification and characterization of a with myo-inositol hexaphosphate is enhanced by the presence phytate-degrading enzyme from germinated faba beans (Vicia of soil microorganisms. Plant Soil 229:47–56 faba var. Alameda). J Agric Food Chem 49:2234–2240 Sajidan A (2002) PhD thesis, Humboldt University, Berlin Greiner R, Farouk A, Alminger ML, Carlsson NG (2002) The Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning, a pathway of dephosphorylation of myo-inositol hexakispho- laboratory manual, 2nd edn. Cold Spring Harbor Laboratory sphate by phytate-degrading enzymes of different Bacillus spp.
Selle PH, Ravindran V, Caldwell RA, Bryden WL (2000) Phytate Hegemann CE, Grabau EA (2001) A novel phytase with sequence and phytase: consequences for protein utilization. Nutr Res Rev similarity to purple acid phosphatases is expressed in cotyle- Shin S, Ha NC, Oh BC, Oh KT, Oh BH (2001) Enzyme mechanism and catalytic property of β propeller phytase. Structure 9:851– Idriss ESE, Makarewicz O, Farouk A, Rosner K, Greiner R, Bochow H, Richter T, Borriss R (2002) Extracellular phytase Skoglund E, Carlsson NG, Sandberg AS (1998) High-performance activity of Bacillus amyloliquefaciens FZB45 contributes to its chromatographic separation of inositol phosphate isomers on plant-growth-promoting effect. Microbiology 148:2097–2109 strong anion exchange columns. J Agric Food Chem 46:1877– Irving GJC, Cosgrove DJ (1971) Inositol phosphate phosphatases of microbiological origin. Some properties of a partially purified Swofford DL (2002) PAUP*. Phylogenetic analysis using parsi- bacterial (Pseudomonas sp.) phytase. Aust J Biol Sci 24:547– mony (*and other methods). Version 4. Sinauer Associates, Jungblut PR, Bumann D, Haas G, Zimny-Arndt U, Holland P, Thompson JD, Higgins D, Gibson TJ (1994) CLUSTALW: Lamer S, Siejak F, Aebischer A, Meyer TF (2000) Comparative improving the sensitivity of progressive multiple sequence proteome analysis of Helicobacter pylori. Mol Microbiol alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res Lassen SF, Breinholt J, Ostergaard PR, Brugger R, Bischoff A, Wyss M, Fuglsang C (2001) Expression, gene cloning, and Tye AJ, Siu FKY, Leung TYC, Lim BL (2002) Molecular cloning characterization of five novel phytases from four basidiomycete and the biochemical characterization of two novel phytases fungi: Peniophora lycii, Agrocybe pediades, a Ceriporia sp., from B. subtilis 168 and B. licheniformis. Appl Microbiol and Trametes pubescens. Appl Environ Microbiol 67:4701– Wyss M, Brugger R, Kronenberger A, Remy R, Fimbel R, Lim D, Golovan S, Forsberg CW, Jia Z (2000) Crystal structures of Oesterhelt G, Lehmann M, Loon AP van (1999) Biochemical Escherichia coli phytase and its complex with phytate. Nat characterization of fungal phytases (myo-inositol hexakispho- sphate phosphohydrolases): catalytic properties. Appl Environ McClelland M, Florea L, Sanderson K, Clifton SW, Parkhill J, Churcher C, Dougan G, Wilson RK, Miller W (2000)Comparison of the Escherichia coli K-12 genome with sampledgenomes of a Klebsiella pneumoniae and three Salmonellaenterica serovars, Typhimurium, Typhi and Paratyphi. NucleicAcids Res 28:4974–4986

Source: http://sajidan.staff.fkip.uns.ac.id/files/2011/02/fulltextjurnal-phytase-sajidan.pdf

Sdi ws

ESDN Workshop on “Experiences with Participatory Tools and Mechanisms” Workshop Outline Hosted by the in cooperation with the German Federal Ministry for the Environment, Nature Conservation and Nuclear Safety & the German Federal Environment Agenda (UBA) Berlin, 9-10 April 2008 Workshop Outline – Experiences with Participatory Tools and Mechanisms Organisatio

tagy.in

All rights reserved ® www.vedicfoundationandtrust.org Contents Introduction . Error! Bookmark not defined. Introduction to a Vedic Style of Life . 3 Introduction Dear All, the translation of Rig Veda Mantra Samhita is complete only with the respective Brahmana translations. The two Brahmanas under consideration are Aitareya and Kausitaki Brahmanas. The major shrauta rites will be di

Copyright © 2010 Medicament Inoculation Pdf